View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21051_low_2 (Length: 259)
Name: NF21051_low_2
Description: NF21051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21051_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 10 - 243
Target Start/End: Complemental strand, 44907720 - 44907468
Alignment:
| Q |
10 |
agaagcatagggctgcattaaattatgagcatcactaagatgcatgaaattgattccctgcagttaggatatt--------------------gctagaa |
89 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
44907720 |
agaaacatggggctgcattaaattatgagcatcactaagatgcatgaaattgattcc-tgcagttaggatattctacattaacatagtgcattgctagaa |
44907622 |
T |
 |
| Q |
90 |
actggattttgaaaatatgcagannnnnnnccccttcaaaatttaaatattgagcttaaaatctagacagtttgatcttgaccaaacggtcattgatgta |
189 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44907621 |
actggattttgaaaatatgcagatttttttccccttcacaatttaaatattgagcttaaaatctagacagtttgatcttgaccaaacggtcattgatgta |
44907522 |
T |
 |
| Q |
190 |
ctaacggtgtgaattcagggtattaccatcacacagaatctttctgcatgttag |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44907521 |
ctaacggtgtgaattcagggtattaccatcacatagaatctttctgcatgttag |
44907468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University