View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21053_high_13 (Length: 281)
Name: NF21053_high_13
Description: NF21053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21053_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 21 - 100
Target Start/End: Original strand, 50592635 - 50592714
Alignment:
| Q |
21 |
gtgcatgcgagtttgtgacacagcaacgtctttcaaaattgcagcccaacagtgtagtggttaatcttgatgtattgtgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
50592635 |
gtgcatgcgagtttgtgacacagcaacgtctttcaaaattgcagcacaacagtgtagcggttaatcttgatgtattgtgc |
50592714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 169 - 210
Target Start/End: Original strand, 3285269 - 3285310
Alignment:
| Q |
169 |
ttttttatagacagatgttattatttgttaatttgttagggg |
210 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
3285269 |
ttttttatagacaaatgctattatttgttaatttgttagggg |
3285310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University