View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21053_high_18 (Length: 244)
Name: NF21053_high_18
Description: NF21053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21053_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 18157126 - 18157210
Alignment:
| Q |
16 |
atatcgcaacaaatacaccgaaatttcacaacacacgtaatatgttgttccagatccttccacaacgttcttttatctctctata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
18157126 |
atatcgcaacaaatacaccgaaatttcacaacacacgtaatatgttgttccagatccttccacgacgttcttttttctctctata |
18157210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 18157293 - 18157341
Alignment:
| Q |
183 |
ctttgctgttttgaattgatttgatggcttcagaagctgaaatttctga |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18157293 |
ctttgctgttttgaattgatttgatggcttcagaagctgaaatttctga |
18157341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University