View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21053_high_18 (Length: 244)

Name: NF21053_high_18
Description: NF21053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21053_high_18
NF21053_high_18
[»] chr5 (2 HSPs)
chr5 (16-100)||(18157126-18157210)
chr5 (183-231)||(18157293-18157341)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 18157126 - 18157210
Alignment:
16 atatcgcaacaaatacaccgaaatttcacaacacacgtaatatgttgttccagatccttccacaacgttcttttatctctctata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||    
18157126 atatcgcaacaaatacaccgaaatttcacaacacacgtaatatgttgttccagatccttccacgacgttcttttttctctctata 18157210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 18157293 - 18157341
Alignment:
183 ctttgctgttttgaattgatttgatggcttcagaagctgaaatttctga 231  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
18157293 ctttgctgttttgaattgatttgatggcttcagaagctgaaatttctga 18157341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University