View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21053_high_22 (Length: 215)
Name: NF21053_high_22
Description: NF21053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21053_high_22 |
 | |
|
| [»] scaffold0110 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 71 - 202
Target Start/End: Complemental strand, 30036410 - 30036281
Alignment:
| Q |
71 |
caaattctatgacaaattcaatccaaaatcagaagccnnnnnnnnnnnatgattaagaacaccaattggattcagtttaattcaggttatttctctgtgc |
170 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30036410 |
caaattctaagacaaattcaatccaaaatcagaagccttttttttt--atcattaagaacaccaattggattcagtttaattcaggttatttctctgtgc |
30036313 |
T |
|
| Q |
171 |
aaattgcaatcagcttcccagtgccttatcct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30036312 |
aaattgcaatcagcttcccagtgccttatcct |
30036281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 71 - 202
Target Start/End: Complemental strand, 30152146 - 30152017
Alignment:
| Q |
71 |
caaattctatgacaaattcaatccaaaatcagaagccnnnnnnnnnnnatgattaagaacaccaattggattcagtttaattcaggttatttctctgtgc |
170 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30152146 |
caaattctaagacaaattcaatccaaaatcagaagccttttttttt--atcattaagaacaccaattggattcagtttaattcaggttatttctctgtgc |
30152049 |
T |
|
| Q |
171 |
aaattgcaatcagcttcccagtgccttatcct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30152048 |
aaattgcaatcagcttcccagtgccttatcct |
30152017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 122 - 200
Target Start/End: Original strand, 41410 - 41488
Alignment:
| Q |
122 |
attaagaacaccaattggattcagtttaattcaggttatttctctgtgcaaattgcaatcagcttcccagtgccttatc |
200 |
Q |
| |
|
||||| ||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41410 |
attaacaacaccaattggattcacttcacttcaggttatttctctgtgcaaattgcaatcagcttcccagtgccttatc |
41488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 41066 - 41108
Alignment:
| Q |
1 |
tctttctttggtatgatgccctctatgttcctcggatccttat |
43 |
Q |
| |
|
||||||||| |||||||||||||||||||||| | |||||||| |
|
|
| T |
41066 |
tctttcttttgtatgatgccctctatgttccttgaatccttat |
41108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University