View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21053_low_11 (Length: 337)
Name: NF21053_low_11
Description: NF21053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21053_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 18 - 327
Target Start/End: Complemental strand, 33893302 - 33892993
Alignment:
| Q |
18 |
gattcaagcagcttcttggtgagaatcctagcccctaggtacaaaattaacatgccaaagagcgatattttcaactttaatatcattagacaattgaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33893302 |
gattcaagcagcttcttggtgagaatcctagcccctaggtacaaaattaacatgccaaagagcgatattttcaactttaatatctttagacaattgaaca |
33893203 |
T |
|
| Q |
118 |
ttggtgtttttatcttacatatttatactttttggcatcttcaatggtgtacttttgagaccattgaatctaatatctcatttgcttcgttgtacaagca |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33893202 |
ttggtgtttttatcttacaaatttatactttttggcatcttcaatggtgtacttttgagaccattgaatctaatatctcatttgcttcgttgtacaagca |
33893103 |
T |
|
| Q |
218 |
aatatacattcgatgaatcattagacaaagtaaaagtactaatttgtttataggtctatattactactttatatataaacacttgaaagatacaaccaca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33893102 |
aatatacattcgatgaatcattagacaaagtaaaagtactaatttgtttataggtctatattactactttatatataaacacttgaaagatacaaccaca |
33893003 |
T |
|
| Q |
318 |
aacaatgcct |
327 |
Q |
| |
|
|||||||||| |
|
|
| T |
33893002 |
aacaatgcct |
33892993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University