View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21053_low_14 (Length: 256)
Name: NF21053_low_14
Description: NF21053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21053_low_14 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 256
Target Start/End: Complemental strand, 6326754 - 6326509
Alignment:
| Q |
11 |
atgttattcgacctgtgttcttttagatatgctggttttgattcaatctctgaaacttatagtagaaaacagaacttaattggttctgttttgtgatgtt |
110 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6326754 |
atgttattcgacctgtattcttttagatatgcaggttttgattcaatctctgaaacttatagtagaaaacagaacttaattggttctgttttgtgatgtt |
6326655 |
T |
|
| Q |
111 |
ctaacatgtttattaaaacattgatgttttgtaaaccgaaccgggctcaaaccggtgagtcccttaggccatgatgtgctcaaaccagagaaaatcacat |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6326654 |
ctaacatgtttattaaaacgttgatgttttgtaaaccggaccgggctcaaaccggtgagacccttaggtcatgatgtgctcaaaccagagaaaatcacat |
6326555 |
T |
|
| Q |
211 |
caaactgccaaaatttagttaaggtctgtggttgaaccgtccaatt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6326554 |
caaactgccaaaatttagttaaggtctgtggttgaaccgtccaatt |
6326509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 105 - 255
Target Start/End: Complemental strand, 6317421 - 6317272
Alignment:
| Q |
105 |
gatgttctaacatgtttattaaaacattgatgttttgtaaaccgaaccgggctcaaaccggtgagtcccttaggccatgatgtgctcaaaccagagaaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||| || ||||||| ||||||||||||||||| |
|
|
| T |
6317421 |
gatgttctaacatgtttattaaaacattgatgttttatatac-----------caaactggtgaaacccttgggtcatgatgcgctcaaaccagagaaaa |
6317333 |
T |
|
| Q |
205 |
tcac-atcaaactg---------ccaaaatttagttaaggtctgtggttgaaccgtccaat |
255 |
Q |
| |
|
|||| ||||||||| ||||| ||||||||||||| || ||||||||||||||| |
|
|
| T |
6317332 |
tcacaatcaaactgcctaagtaaccaaactttagttaaggtcggtagttgaaccgtccaat |
6317272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 24 - 62
Target Start/End: Complemental strand, 6317521 - 6317483
Alignment:
| Q |
24 |
tgtgttcttttagatatgctggttttgattcaatctctg |
62 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6317521 |
tgtgttcttttagatatgcaggttttgattcaatctctg |
6317483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 39832427 - 39832379
Alignment:
| Q |
13 |
gttattcgacctgtgttcttttagatatgctggttttgattcaatctct |
61 |
Q |
| |
|
||||||| || ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39832427 |
gttattccacttgtgttcttttagatatgcaggttttgattcaatctct |
39832379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University