View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21053_low_19 (Length: 241)
Name: NF21053_low_19
Description: NF21053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21053_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 10845905 - 10845680
Alignment:
| Q |
1 |
tgttaagcttttggatattgaaggtttacaaggacatcgtgaatggcttgtaagtactatattgattatgacacatgtannnnnnnnaacgttttaaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10845905 |
tgttaagcttttggatattgaaggtttacaaggacatcgtgaatggcttgtaagtactatattgattatgacacatgtattttttt-aacgttttaaaaa |
10845807 |
T |
 |
| Q |
101 |
ccggttgaaccacaaacaacactatctacggttcggttatcttagttactataatttatgacacaaaaaattaagaaaattgtctataaagttatcttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10845806 |
ccggttgaaccacaaacaacactatctacggttcggttatcttagtta---taatttatgacacaaaa--ttaagaaaattgtctataaagttatcttag |
10845712 |
T |
 |
| Q |
201 |
aatttctttactttatttttatgatgatgatg |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
10845711 |
aatttctttattttatttttatgatgatgatg |
10845680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University