View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21054_low_6 (Length: 341)
Name: NF21054_low_6
Description: NF21054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21054_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 174 - 292
Target Start/End: Original strand, 19226996 - 19227118
Alignment:
| Q |
174 |
atcaaattttaacgcagaaacaattgtgagttttgatgnnnnnnnn----aacaaattgatgttgtcactcattcaattatgtttaggcattataaatgt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19226996 |
atcaaattttaacgcagaaacaattgtgagttttgatgttttttttttttaacaaattgatgttgtcactcattcaatgatgtttaggcattataaatgt |
19227095 |
T |
 |
| Q |
270 |
gataaatagtaatggatttttgg |
292 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
19227096 |
gataaatagtaatggacttttgg |
19227118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 19226832 - 19226900
Alignment:
| Q |
1 |
acacaaatgtttaaatctcctatgataaaagcatgtatgtgaacctcaatagatgatgcctagtaatgg |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19226832 |
acacaaatgtttaaatctcctatgataaaagcatgtatgtgaacctcaatagatgatgcctagtaatgg |
19226900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University