View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21054_low_7 (Length: 269)
Name: NF21054_low_7
Description: NF21054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21054_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 29 - 258
Target Start/End: Complemental strand, 24508391 - 24508162
Alignment:
| Q |
29 |
acttaaagaacagacaaatttatttaaaaataaagtctgacttttttcatgacnnnnnnnnggtcaagttttcatagcttttatattatgatattgataa |
128 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24508391 |
acttaaagaacagataaatttatttaaaaataaagtctgacttttttcatgacttttttttgatcaagttttcatagcttttatattatgatatttataa |
24508292 |
T |
|
| Q |
129 |
cactttactattgaaataaataatannnnnnnattacaaaaaataataatataaatacttgcttataaaagcgacctttgaccgttatatcatctagaca |
228 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24508291 |
cactttattattgaaataaataatatttttttattacaaaaaataataatataaatacttgcttataaaagcgacctttgaccgttatatcagctagaca |
24508192 |
T |
|
| Q |
229 |
ctctttctatctcaaaatctcccacccttt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24508191 |
ctctttctatctcaaaatctcccacccttt |
24508162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University