View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21055_high_12 (Length: 202)
Name: NF21055_high_12
Description: NF21055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21055_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 20 - 186
Target Start/End: Complemental strand, 1554947 - 1554781
Alignment:
| Q |
20 |
tcaaataaataatatgcaaacatacccttaagaaggttagtgctaaaattaatcgatcctctaccatctgccaatgtttgcttaaagcaaattctttgcg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1554947 |
tcaaataaataatatgcaaacatacccttaagaaggttagtgctaaaattaattgatcctctaccatctgccaatgtttgcttaaatcaaattctttgcg |
1554848 |
T |
|
| Q |
120 |
caggcttggtttcttagtgatgaagaaatgactgctcataaataaacaaggtatttggaggatatgt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1554847 |
caggcttggtttcttagtgatgaagaaatgactagtcataaataaacaaggtatttggaggatatgt |
1554781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University