View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21055_low_13 (Length: 234)
Name: NF21055_low_13
Description: NF21055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21055_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 10 - 210
Target Start/End: Complemental strand, 28684486 - 28684285
Alignment:
| Q |
10 |
atgtcgaagaaaatgtgggatacacaaataagttttctctttcgatataannnnnnn-atacacacgagcctttgatcacatgttttacaacttggatcg |
108 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28684486 |
atgtcgaagaatatgtggggtacacaaataaattttctctttcgatataattttttctatacgcacgagcctttgatcacatgttttacaacttggatcg |
28684387 |
T |
 |
| Q |
109 |
atccattgttagtgaataaatttgtatatcttatagtatatgtgtgtaaattttcacataaattatttaaaaatatccaatatatattgaatagtcaaat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28684386 |
atccattgttagtgaataaatttgtatatcttatagtatatgtgtataaattttcacataaattatttaaaaatatccaatatatattgaatagtcaaat |
28684287 |
T |
 |
| Q |
209 |
ta |
210 |
Q |
| |
|
|| |
|
|
| T |
28684286 |
ta |
28684285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University