View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21055_low_16 (Length: 202)

Name: NF21055_low_16
Description: NF21055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21055_low_16
NF21055_low_16
[»] chr4 (1 HSPs)
chr4 (20-186)||(1554781-1554947)


Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 20 - 186
Target Start/End: Complemental strand, 1554947 - 1554781
Alignment:
20 tcaaataaataatatgcaaacatacccttaagaaggttagtgctaaaattaatcgatcctctaccatctgccaatgtttgcttaaagcaaattctttgcg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||    
1554947 tcaaataaataatatgcaaacatacccttaagaaggttagtgctaaaattaattgatcctctaccatctgccaatgtttgcttaaatcaaattctttgcg 1554848  T
120 caggcttggtttcttagtgatgaagaaatgactgctcataaataaacaaggtatttggaggatatgt 186  Q
    |||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
1554847 caggcttggtttcttagtgatgaagaaatgactagtcataaataaacaaggtatttggaggatatgt 1554781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University