View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21055_low_5 (Length: 427)
Name: NF21055_low_5
Description: NF21055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21055_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 17 - 415
Target Start/End: Complemental strand, 55452367 - 55451948
Alignment:
| Q |
17 |
acatggagtattaccaggccaatcacatgcaaaacgagtatnnnnnnn-ttaatatcaaggtaacgaattgaaatgagaaatgatcacaaacaagctagc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55452367 |
acatggagtattaccaggccaatcacatgcaaaacgagtataaaaaaaattaatatcaaggtaacgaattgaaatgagaaatgatcacaaacaagctagc |
55452268 |
T |
 |
| Q |
116 |
taatggaaataaataaatttatctgcacaaacattgtttacatacctctcctacgtaccgttgcatttttggcacctgaaaatggctgctaccatctagg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55452267 |
taatggaaataaataaatttatctgcacaaacattgtttacatacctctcctacgtaccgttgcatttttggcacctgaaaatggctgctaccagctagg |
55452168 |
T |
 |
| Q |
216 |
gatggcaaaaacaccc--------------------ataaaatctaacacggttacaggctcataccttgataaagtaagggtaaaatgacttaaatatc |
295 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55452167 |
gatggcaaaaacaccctacccggcgggtatccactaataaaatctgacacggttacaggctcataccttgataaagtaagtgtaaaatgacttaaatatc |
55452068 |
T |
 |
| Q |
296 |
cttaggttaagtataaaagttagcagttccgtcaaaacaccccagatatcaactatttaggttat----ttttctctttcagatctcactgactgcttcc |
391 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
55452067 |
cttaggttaagtataaaatttagcagttccgtcaaaacaccccagatatcaactatttaggttatttaattttctctttcagatctc----actgcttcc |
55451972 |
T |
 |
| Q |
392 |
ccatccatcaacactgtaactctc |
415 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
55451971 |
ccatccatccacactgtaactctc |
55451948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 349 - 382
Target Start/End: Original strand, 55466284 - 55466317
Alignment:
| Q |
349 |
tatttaggttatttttctctttcagatctcactg |
382 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
55466284 |
tatttaggttatttttctctttcatatctcactg |
55466317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University