View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21055_low_7 (Length: 328)
Name: NF21055_low_7
Description: NF21055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21055_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 6686434 - 6686123
Alignment:
| Q |
1 |
acgtccgataacaaccagttctaattgcttagaatctgatcatattattattggtagaactgatgagaaaatgaagatggtaagcatgctgcttgaacaa |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6686434 |
acgtctgataacaaccagttctaattgcttagaatctgatcatattattattggtagaactgatgagaaaatgaagatggtaagcatgttgcttgaacaa |
6686335 |
T |
|
| Q |
101 |
gactccaatgttaatgttatttcctctgttgctattgttggtctttgtggtatatataggcaagaccactcttgctcaaatggtgtacaatgatgctaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6686334 |
gactccaatgttaatgttatttcctctgttgctattgttggtcttggtggtatatataggcaagactactcttgctcaaatggtgtacaatgatgctaag |
6686235 |
T |
|
| Q |
201 |
gtcaaaggcttatttgaaaaccaagtttggtttcatgtttcttactcattcaatgtccaagcttttgcgaagcaaatcttacaagctttatttggagatg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6686234 |
gtcaaaggcttatttgaaaaccaagtttggtttcatgtttcttactcattcgatatccaagcttttgcgaagcaaatcttacaagctttatttggagatg |
6686135 |
T |
|
| Q |
301 |
atatcaatgatc |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6686134 |
atatcaatgatc |
6686123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University