View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21056_low_13 (Length: 256)
Name: NF21056_low_13
Description: NF21056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21056_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 7181245 - 7181163
Alignment:
| Q |
1 |
agagaaaataattttgtttcaccatgttaccaattctttcaaatagttgtatatcaaattagagttaacctttttcgatgttt |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7181245 |
agagaaaataattttgtttcaccatgttaccaaatctttcaaattgttgtatatcaaattagagttaacctttttcgatgttt |
7181163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 7181148 - 7181095
Alignment:
| Q |
151 |
gttcctatccacttactaagaatcaaataccaaactcttccgacaaagcgacac |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7181148 |
gttcctatccacttattaagaatcaaataccaaactctttcgacaaagcgacac |
7181095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University