View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21057_high_11 (Length: 201)

Name: NF21057_high_11
Description: NF21057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21057_high_11
NF21057_high_11
[»] chr2 (1 HSPs)
chr2 (15-184)||(28427010-28427179)


Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 15 - 184
Target Start/End: Complemental strand, 28427179 - 28427010
Alignment:
15 atatgcaaactttgaatgttttgtgtttttggatataggtataactgtgaggtatgaagtaaaattatctcttatacgtgaataaattacggggaagcta 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
28427179 atatgcaaactttgaatgttttgtgtttttggatataggtataactgtgaggtatgaagtaaaattctctcttatacgtgaataaattacggggaagcta 28427080  T
115 ggaactagaattctatgactatgaatacttggtgtttttcttcttttcttgggatttatttatagcactg 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28427079 ggaactagaattctatgactatgaatacttggtgtttttcttcttttcttgggatttatttatagcactg 28427010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University