View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21057_high_6 (Length: 241)
Name: NF21057_high_6
Description: NF21057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21057_high_6 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 13085405 - 13085186
Alignment:
| Q |
13 |
tcatatataaggtcccttcgcgtcagaattttttcaatcgttaggttatagttgattcatatagtgttggtgtgggatatgtggaaagggttggagccgg |
112 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13085405 |
tcatatataaggtcccttcgcgtcataattttttcaatcgttaggttatagttaat---------gttggtgtgggatatgtggaaagggttggagccgg |
13085315 |
T |
 |
| Q |
113 |
tggatctttatttgtgtcatgttgagttgtggcgagagtttggtacgatatttgcatgcggttaggttgggagtgggtcttgtcaggtaatttggtggtg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13085314 |
tggatctttatttgtgtcatgttgagttgtggcgagagtttggtacgatatttgcaggcggttaggttgggagtgggtcttgtcaggtaatttggtggtg |
13085215 |
T |
 |
| Q |
213 |
ttgtttcaggtgtttgtattcttaaaggc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13085214 |
ttgtttcaggtgtttgtattcttaaaggc |
13085186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 13 - 204
Target Start/End: Complemental strand, 13014028 - 13013846
Alignment:
| Q |
13 |
tcatatataaggtcccttcgcgtcagaattttttcaatcgttaggttatagttgattcatatagtgttggtgtgggatatgtggaaagggttggagccgg |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13014028 |
tcatatataaggtcccttcgcgtcataattttttcaattgttaggttatagtt---------agtgttggtgtgggatatgtggaaagggttggagccgg |
13013938 |
T |
 |
| Q |
113 |
tggatctttatttgtgtcatgttgagttgtggcgagagtttggtacgatatttgcatgcggttaggttgggagtgggtcttgtcaggtaatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13013937 |
tggatctttatttgtgtcatgttgagttgtggcgagagtttggtacgatatttgcaggcggttaggttgggagtgggtcttgtcaggtaatt |
13013846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University