View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21057_high_8 (Length: 213)

Name: NF21057_high_8
Description: NF21057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21057_high_8
NF21057_high_8
[»] chr6 (14 HSPs)
chr6 (15-195)||(28097492-28097672)
chr6 (12-186)||(28326428-28326602)
chr6 (12-186)||(28504064-28504238)
chr6 (12-186)||(28182068-28182242)
chr6 (12-186)||(28227902-28228076)
chr6 (12-173)||(28235515-28235676)
chr6 (12-186)||(28296798-28296972)
chr6 (12-186)||(28515101-28515275)
chr6 (98-173)||(28243831-28243906)
chr6 (12-170)||(29826936-29827094)
chr6 (89-173)||(29523057-29523141)
chr6 (99-185)||(26892649-26892735)
chr6 (98-183)||(26862616-26862701)
chr6 (29-156)||(27697674-27697801)
[»] chr2 (2 HSPs)
chr2 (12-186)||(3280609-3280783)
chr2 (12-170)||(17992289-17992447)
[»] scaffold0038 (3 HSPs)
scaffold0038 (12-186)||(28400-28574)
scaffold0038 (12-173)||(35677-35838)
scaffold0038 (98-173)||(43993-44068)
[»] chr5 (1 HSPs)
chr5 (15-172)||(16691820-16691977)
[»] chr4 (1 HSPs)
chr4 (16-181)||(5090013-5090178)
[»] scaffold0019 (1 HSPs)
scaffold0019 (83-186)||(57352-57455)
[»] chr8 (1 HSPs)
chr8 (97-185)||(16441091-16441179)


Alignment Details
Target: chr6 (Bit Score: 177; Significance: 1e-95; HSPs: 14)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 28097672 - 28097492
Alignment:
15 caaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtgctg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
28097672 caaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctatggctggagggactgattggtttggtgctg 28097573  T
115 gcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatgaaacacacgagt 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28097572 gcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatgaaacacacgagt 28097492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 28326428 - 28326602
Alignment:
12 aagcaaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtg 111  Q
    ||||||||||| || | |||||||||||| ||||||||||| ||  || |  || |||||||  |||| | ||||||||||||   ||||||||| |||     
28326428 aagcaaaggcttcaccgaaagaaggttctgttgattctcgatgatgttcacgaactgaagcaattgcaggttttggctggaggacttgattggttcggtc 28326527  T
112 ctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatgaaa 186  Q
    |||||||||||||||| |||||||||||||| ||| | ||||||  |||||| |||||||||  | |||||||||    
28326528 ctggcagtagagtgatcgttaccactcgagacaaacatttgctaaaaagtcacgggattgaaagagcatatgaaa 28326602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 28504064 - 28504238
Alignment:
12 aagcaaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtg 111  Q
    ||||||||||| || | |||||||||||| ||||||||||| ||  || |  || |||||||  |||| | ||||||||||||   ||||||||| |||     
28504064 aagcaaaggcttcaccgaaagaaggttctgttgattctcgatgatgttcacgaactgaagcaattgcaggttttggctggaggacttgattggttcggtc 28504163  T
112 ctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatgaaa 186  Q
    |||||||||||||||| |||||||||||||| ||| | ||||||  |||||| |||||||||  | |||||||||    
28504164 ctggcagtagagtgatcgttaccactcgagacaaacatttgctaaaaagtcacgggattgaaagagcatatgaaa 28504238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 28182068 - 28182242
Alignment:
12 aagcaaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtg 111  Q
    ||||||||||| || | ||||||||||||||||||||| || ||  || |  || |||||||  |||| | |||||||||||| | |||||||||||||     
28182068 aagcaaaggcttcaccgaaagaaggttctattgattctagatgatgttcacgaactgaagcaattgcaggttttggctggaggaattgattggtttggtc 28182167  T
112 ctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatgaaa 186  Q
    |||| |||| ||||||  |||||||||||||  || | ||||||| | ||||||||||||||  | |||||||||    
28182168 ctggtagtaaagtgatcattaccactcgagacgaacaattgctagtaggtcatgggattgaaagagcatatgaaa 28182242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 28227902 - 28228076
Alignment:
12 aagcaaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtg 111  Q
    ||||||||||| || | |||||| ||||||||||||||||| ||  || | ||| | |||||  |||  | ||||||||||||   |||||||||||||     
28227902 aagcaaaggcttcaccgaaagaaagttctattgattctcgatgatgttcacaaactaaagcaattgcgggttttggctggaggacttgattggtttggtc 28228001  T
112 ctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatgaaa 186  Q
    |||| |||| ||||||  ||||||||||| | ||| | ||||||||||||||||||||||||  | |||||||||    
28228002 ctggaagtaaagtgatcattaccactcgaaacaaacaattgctagcaagtcatgggattgaaagagcatatgaaa 28228076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 173
Target Start/End: Original strand, 28235515 - 28235676
Alignment:
12 aagcaaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtg 111  Q
    ||||||||||| || | |||||||||||| |||||||| || ||  || |  || | |||||  |||| | |||||| ||||  | |||||||||||||     
28235515 aagcaaaggcttcaccgaaagaaggttctgttgattctagatgatgttcacgaactaaagcaattgcaggttttggcgggagaaattgattggtttggtc 28235614  T
112 ctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaa 173  Q
    |||| |||| ||||||  ||||||||||||| ||| | ||||||||||||||||||||||||    
28235615 ctggaagtaaagtgatcattaccactcgagacaaacaattgctagcaagtcatgggattgaa 28235676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 12 - 186
Target Start/End: Complemental strand, 28296972 - 28296798
Alignment:
12 aagcaaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtg 111  Q
    ||||||||||| || | |||||||||| | |||||||| || ||  || || || |||||||  |||||| |||||||||| |   |||||||||||||     
28296972 aagcaaaggcttcaccgaaagaaggttttgttgattctagatgatgttcatgaactgaagcaattgcaagttttggctggacgacttgattggtttggtc 28296873  T
112 ctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatgaaa 186  Q
     ||| |||| ||||||  ||||||||| ||| ||||| |||||||   ||||||||||||||  | |||||||||    
28296872 ttggaagtaaagtgatcattaccactcaagaaaaaaaattgctagatggtcatgggattgaaagagcatatgaaa 28296798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 28515101 - 28515275
Alignment:
12 aagcaaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtg 111  Q
    ||||||||||| || | |||||||||| | |||||||| || ||  || || || |||||||  |||||| |||||||||| |   |||||||||||||     
28515101 aagcaaaggcttcaccgaaagaaggttttgttgattctagatgatgttcatgaactgaagcaattgcaagttttggctggacgacttgattggtttggtc 28515200  T
112 ctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatgaaa 186  Q
     ||| |||| ||||||  ||||||||| ||| ||||| |||||||   ||||||||||||||  | |||||||||    
28515201 ttggaagtaaagtgatcattaccactcaagaaaaaaaattgctagatggtcatgggattgaaagagcatatgaaa 28515275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 28243831 - 28243906
Alignment:
98 tgattggtttggtgctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaa 173  Q
    ||||||||| ||| |||| ||||||||||| |||||||||||||| | | | ||||||  ||||||||||||||||    
28243831 tgattggttcggtcctggtagtagagtgatcgttaccactcgagacagacatttgctaaaaagtcatgggattgaa 28243906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 12 - 170
Target Start/End: Original strand, 29826936 - 29827094
Alignment:
12 aagcaaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtg 111  Q
    ||||||||||||  || |||||| || || |||||||| |||||| || | ||  ||| |||  |||||| | |||| |||||   |||||||||||||     
29826936 aagcaaaggctaggacgaaagaaagtacttttgattcttgacgacgttgacaacatgaggcaattgcaagttatggcgggaggacttgattggtttggtc 29827035  T
112 ctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggatt 170  Q
    ||||||| | ||||||  |||||||||||||  || | |||||| ||||||||||||||    
29827036 ctggcagcatagtgatcattaccactcgagaccaacatttgctaacaagtcatgggatt 29827094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 173
Target Start/End: Original strand, 29523057 - 29523141
Alignment:
89 tggagggactgattggtttggtgctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaa 173  Q
    |||||| ||||||||||||||| |||| || ||||| |||||||| ||| | || ||| | |||||||||  |||||||||||||    
29523057 tggaggaactgattggtttggttctggtagcagagttattgttacaacttgcgacaaacatttgctagcatttcatgggattgaa 29523141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 185
Target Start/End: Complemental strand, 26892735 - 26892649
Alignment:
99 gattggtttggtgctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatgaa 185  Q
    ||||||||||||  ||| ||| ||||||| ||||| |||||||| | ||| |||||||||||||||   ||||||  ||||||||||    
26892735 gattggtttggtattggtagtcgagtgatcgttactactcgagacagaaatttgctagcaagtcatcatattgaaaaaacatatgaa 26892649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 98 - 183
Target Start/End: Original strand, 26862616 - 26862701
Alignment:
98 tgattggtttggtgctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatg 183  Q
    |||||||||||||  ||| |||||||| ||  ||||||||||||||||| |||| ||| || | |||||||| |||  ||||||||    
26862616 tgattggtttggtcatggaagtagagtcatcattaccactcgagataaacacttactaacatgccatgggatagaaagaacatatg 26862701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 156
Target Start/End: Complemental strand, 27697801 - 27697674
Alignment:
29 aaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggact-gattggtttggtgctggcagtagagtgat 127  Q
    ||||||| |||| ||||||||||||||  || | ||| || | ||||| || |||||||||||| ||||| |||||||||||| |||| || ||||| ||    
27697801 aaagaagattcttttgattctcgacgatgttgacaaactggatcagctacaggctttggctgga-ggactcgattggtttggtcctggaagcagagtcat 27697703  T
128 tgttaccactcgagataaaaacttgctag 156  Q
      | ||||| ||||||||| |||| ||||    
27697702 catcaccacccgagataaacacttactag 27697674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 3280609 - 3280783
Alignment:
12 aagcaaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtg 111  Q
    |||||||||||||| |  || |||||||||||| |||| || ||| ||||  ||||||||||| ||||||  || |||||||||  |||||||||| |||    
3280609 aagcaaaggctacaccggaaaaaggttctattggttcttgatgacgttaacgaattgaagcaggtgcaagtcttagctggagggcttgattggtttagtg 3280708  T
112 ctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatgaaa 186  Q
     ||| ||||| |||||  ||||||||||||| ||| ||||| || ||||||||||||||||| ||||||||||||    
3280709 ttggtagtagggtgatcattaccactcgagacaaacacttgttatcaagtcatgggattgaactaacatatgaaa 3280783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 170
Target Start/End: Complemental strand, 17992447 - 17992289
Alignment:
12 aagcaaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtg 111  Q
    ||||||||||||   |||||||| ||||| ||||||||||| |||||  | ||| | |||||  |||| | ||||| ||||| | ||| |||| |||||     
17992447 aagcaaaggctatgtcaaaagaaagttctcttgattctcgatgacatcgacaaactaaagcaattgcaggttttggttggagagcctggttggcttggtc 17992348  T
112 ctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggatt 170  Q
     |||||| ||||| ||  ||||||||||||| ||| | ||| || || |||||||||||    
17992347 gtggcagcagagtcatcattaccactcgagacaaacatttgttaacatgtcatgggatt 17992289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 28400 - 28574
Alignment:
12 aagcaaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtg 111  Q
    ||||||||||| || | |||||| ||||||||||||||||| ||  || | ||| | |||||  |||  | ||||||||||||   |||||||||||||     
28400 aagcaaaggcttcaccgaaagaaagttctattgattctcgatgatgttcacaaactaaagcaattgcgggttttggctggaggacttgattggtttggtc 28499  T
112 ctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatgaaa 186  Q
    |||| |||| ||||||  ||||||||||| | ||| | ||||||||||||||||||||||||  | |||||||||    
28500 ctggaagtaaagtgatcattaccactcgaaacaaacaattgctagcaagtcatgggattgaaagagcatatgaaa 28574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 173
Target Start/End: Original strand, 35677 - 35838
Alignment:
12 aagcaaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtg 111  Q
    ||||||||||| || | |||||||||||| |||||||| || ||  || |  || | |||||  |||| | |||||| ||||  | |||||||||||||     
35677 aagcaaaggcttcaccgaaagaaggttctgttgattctagatgatgttcacgaactaaagcaattgcaggttttggcgggagaaattgattggtttggtc 35776  T
112 ctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaa 173  Q
    |||| |||| ||||||  ||||||||||||| ||| | ||||||||||||||||||||||||    
35777 ctggaagtaaagtgatcattaccactcgagacaaacaattgctagcaagtcatgggattgaa 35838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 43993 - 44068
Alignment:
98 tgattggtttggtgctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaa 173  Q
    ||||||||| ||| |||| ||||||||||| |||||||||||||| | | | ||||||  ||||||||||||||||    
43993 tgattggttcggtcctggtagtagagtgatcgttaccactcgagacagacatttgctaaaaagtcatgggattgaa 44068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 15 - 172
Target Start/End: Original strand, 16691820 - 16691977
Alignment:
15 caaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtgctg 114  Q
    ||||||||||||||||| |||||||| ||||||||||| ||  || || |    |||||  |||||| | ||| ||||| | | |||||||||||| |||    
16691820 caaaggctacaacaaaaaaaggttcttttgattctcgatgatgttgatgagcaaaagcaattgcaagttatggttggagagcccgattggtttggtcctg 16691919  T
115 gcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattga 172  Q
    | |||||||| ||  ||||||||||||| ||| |||| ||| |||||||||| |||||    
16691920 gaagtagagtcatcattaccactcgagacaaacacttactaacaagtcatggtattga 16691977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 16 - 181
Target Start/End: Complemental strand, 5090178 - 5090013
Alignment:
16 aaaggctacaacaaaagaaggttctattgattctcgacgacattaataaattgaagcagctgcaagctttggctggagggactgattggtttggtgctgg 115  Q
    |||||||||||  |||||| ||||| ||||||||||| || ||| | ||| |||| || || || | |||||| ||||   ||||||||||||||  |||    
5090178 aaaggctacaaagaaagaaagttcttttgattctcgatgatattgacaaactgaaacaactacaggttttggccggagaacctgattggtttggtcttgg 5090079  T
116 cagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacata 181  Q
    ||| ||||| ||  ||||||||||||| ||| ||||||||  | |||||||||||||  |||||||    
5090078 cagcagagtcatcattaccactcgagacaaacacttgctaaaatgtcatgggattgatataacata 5090013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 83 - 186
Target Start/End: Complemental strand, 57455 - 57352
Alignment:
83 tttggctggagggactgattggtttggtgctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatat 182  Q
    ||||||||||||   ||||||||||||| |||| |||| ||||||  |||||||||||||  || | ||||||||| ||||||||||||||  | |||||    
57455 tttggctggaggacttgattggtttggtcctggtagtaaagtgatcattaccactcgagacgaacaattgctagcaggtcatgggattgaaagagcatat 57356  T
183 gaaa 186  Q
    ||||    
57355 gaaa 57352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 185
Target Start/End: Original strand, 16441091 - 16441179
Alignment:
97 ctgattggtttggtgctggcagtagagtgattgttaccactcgagataaaaacttgctagcaagtcatgggattgaagtaacatatgaa 185  Q
    ||||||||| |||| |||| || ||||| ||  |||| ||||| || ||| | |||||||||||||||||| |||||  ||||||||||    
16441091 ctgattggtatggtcctggtagcagagttatcattacaactcgggacaaacagttgctagcaagtcatggggttgaaagaacatatgaa 16441179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University