View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21058_low_2 (Length: 421)
Name: NF21058_low_2
Description: NF21058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21058_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 15 - 406
Target Start/End: Original strand, 14021622 - 14022013
Alignment:
| Q |
15 |
catcatcaagctcttccctcgtactctgcgttcctccaccgccaccagaagttgatggcaaagcaagtgtcccagtcctctgctgtccagatacatgcaa |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14021622 |
catcttcaagctcttccctcgtactctgcgtccctccaccgccaccagaagtagacggcaaagcaagtgtcccagtcctctgctgtccagaaacatgcaa |
14021721 |
T |
 |
| Q |
115 |
ataccccgctggagttcgataataagccgcgaactgtggcggaggtggtggatggtgatgatggtgtgtcaacagaaaagggtcaccggcagtaacatct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021722 |
ataccccgctggagttcgataataagccgcgaattgtggcggaggtggtggatggtgatgatggtgtgtcaacagaaaagggtcaccggcagtaacatct |
14021821 |
T |
 |
| Q |
215 |
gccgatgactcttttcggtggaagttacggtggcagttacaagcagcacattttagtgactccaaagttccttcacttcctgccggcataaactcaccgc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021822 |
gccgatgactcttttcggtggaagttacggtggcagttacaagcagcacattttagtgactccaaagttccttcacttcctgccggcataaactcaccgc |
14021921 |
T |
 |
| Q |
315 |
aaccatcaagagcatgaccaccaatacctacagcatgattcttcagacactctctataccttgctttaccatttccaacaacaccacctatg |
406 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021922 |
aaccatcaagagcatgacccccaatacctacagcatgattcttcagacactctctataccttgctttaccatttccaacaacaccacctatg |
14022013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 230 - 269
Target Start/End: Original strand, 2494675 - 2494714
Alignment:
| Q |
230 |
cggtggaagttacggtggcagttacaagcagcacatttta |
269 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2494675 |
cggtggaagttacggtggcagccacaagcagcacatttta |
2494714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University