View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21059_high_5 (Length: 250)
Name: NF21059_high_5
Description: NF21059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21059_high_5 |
 |  |
|
| [»] scaffold0200 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0200 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 31267 - 31394
Alignment:
| Q |
1 |
tacatcacccctgtagtcatggtttcccaacactgcatgcagatcattaaccatgttattacatttgtaatttatagtcaagaatacaaattactagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31267 |
tacatcacccctgtagtcatggtttcccaacactgcatgcagatcattaaccatgttattacatttgtaatttatagtcaagaatacaaattac-agaaa |
31365 |
T |
 |
| Q |
101 |
aagtcctaaattgcggtatacaattacag |
129 |
Q |
| |
|
|| |||||||||||||||||||||||||| |
|
|
| T |
31366 |
aaatcctaaattgcggtatacaattacag |
31394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 131 - 242
Target Start/End: Complemental strand, 26615088 - 26614977
Alignment:
| Q |
131 |
aacgatgtaaagattttaaggtttttacaaccgtaattgtggctgcagttttttcatatgtgtctgatatctgacacgtgtcactgttagtgtcgtgtct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26615088 |
aacgatgtaaagattttaaggtttttacaaccgtaattgtggctgcagttttttcatacgtgtctgatatctgacacgtgtcactgttagtgtcgtgtct |
26614989 |
T |
 |
| Q |
231 |
ggtgtctgtgct |
242 |
Q |
| |
|
|||||||||||| |
|
|
| T |
26614988 |
ggtgtctgtgct |
26614977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University