View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21059_high_6 (Length: 243)
Name: NF21059_high_6
Description: NF21059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21059_high_6 |
 |  |
|
| [»] scaffold0200 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0200 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 31283 - 31063
Alignment:
| Q |
1 |
actacaggggtgatgtagaggctcaattgagcccattccttagacaaattgatagtaggtggctttgtttaaggtctttcattgtagattcaggtatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31283 |
actacaggggtgatgtagaggctcaattgagcccattccttagacaaattgatagtaggtggctttgtttaaggtctttcattgtagattcaggtatttt |
31184 |
T |
 |
| Q |
101 |
ctttgttgcatgttattttcaagttaatgaaatgcttaaaaatcatgttcatgtagnnnnnnnnnctttctaaatgtatatttttgttcttgtgcagagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
31183 |
ctttgttgcatgttattttcaagttaatgaaatgtttaaaaatcatgttcatgtagttttttt---tttct-tatgtatatttttgttcttgtgcagagc |
31088 |
T |
 |
| Q |
201 |
tggttgagattttctttgttgacac |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31087 |
tggttgagattttctttgttgacac |
31063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University