View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21059_low_6 (Length: 257)
Name: NF21059_low_6
Description: NF21059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21059_low_6 |
 | |
|
| [»] scaffold0037 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 68 - 229
Target Start/End: Original strand, 8059273 - 8059434
Alignment:
| Q |
68 |
tatgtagctcacacaatcataaatccaatttgtcattcatatcgtgaagctgacactagcaccgatggtttggagaatacaggttatgatttcgttgatg |
167 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8059273 |
tatgtagatcacacaatcataaatccaatttgtcattcatatcgtgaagctgacactagcaccgatggtttggagaatacaggttgtgatttcgttgatg |
8059372 |
T |
|
| Q |
168 |
gttgaactgtttgagtcttgttcgacgcacttaaatcaactattgttttttatattcttgga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8059373 |
gttgaactgtttgagtcttgttcgacgcacttaaatcaactattgttttttatattattgga |
8059434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0037
Description:
Target: scaffold0037; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 115
Target Start/End: Complemental strand, 34691 - 34661
Alignment:
| Q |
85 |
cataaatccaatttgtcattcatatcgtgaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34691 |
cataaatccaatttgtcattcatatcgtgaa |
34661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University