View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2105_low_7 (Length: 212)
Name: NF2105_low_7
Description: NF2105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2105_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 17 - 202
Target Start/End: Original strand, 1324897 - 1325082
Alignment:
| Q |
17 |
aattagtgatggctcggtttgnnnnnnngtctctcttattcttattcttattcttaattgatggttctaagagtgagcttcatgttggtttctactccaa |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1324897 |
aattagtgatggctcggtttgtttttttgtctctcttattcttattcttattcttaattgatggttctaagagtcagcttcatgttggtttctactccaa |
1324996 |
T |
 |
| Q |
117 |
cacatgtcctcaagtagagtccactgtccatgatgttgttagagaagctgttctttttgacagaaccaaggctgctgttcatctca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1324997 |
cacatgtcctcaagtagagtccactgtccatgatgttgttagagaagctgttctttttgacagaaccaaggctgctgttcttctca |
1325082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University