View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21062_high_12 (Length: 275)
Name: NF21062_high_12
Description: NF21062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21062_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 2786164 - 2786378
Alignment:
| Q |
9 |
acatcatcaactttaacatgaatttgatttgaaggcaagtttgttgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaa |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786164 |
acatcgtcaactttaacatgaatttgatttgaaggcaagtttgttgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaa |
2786263 |
T |
|
| Q |
109 |
caagagggggtttcgcatcaacaggtggattgacagctccagcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaat |
208 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786264 |
caagagggggtttagcatcaaccggtggattgacagctccagcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaat |
2786363 |
T |
|
| Q |
209 |
agaaaactgcggaaa |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2786364 |
agaaaactgcggaaa |
2786378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 258
Target Start/End: Complemental strand, 2784872 - 2784821
Alignment:
| Q |
207 |
atagaaaactgcggaaaatgactgtgttagcagtggcaatgtaaggaatttt |
258 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2784872 |
atagaaaactgcagaaaatgattgtgttagcagtggcaatgtaaggaatttt |
2784821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 209
Target Start/End: Complemental strand, 22517521 - 22517462
Alignment:
| Q |
150 |
gcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaata |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||| | | ||||||||| ||| |||||||||||| |
|
|
| T |
22517521 |
gcattgtagatggctttaattttgggaagttgttttgggcagacgaccgatagagaaata |
22517462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 64 - 113
Target Start/End: Complemental strand, 22518281 - 22518232
Alignment:
| Q |
64 |
gactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaacaaga |
113 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
22518281 |
gactcaaggcactgcgggcttccctaaaaccttctgatattaaaataaga |
22518232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University