View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21062_high_8 (Length: 403)
Name: NF21062_high_8
Description: NF21062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21062_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 249 - 393
Target Start/End: Original strand, 44221722 - 44221866
Alignment:
| Q |
249 |
gcagcttgtgctgtaagcggggctctatatacattaatttgttgtgtgacgggttgtggttgtttatactcatgcatctaccgtaacaaaatgagacaac |
348 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44221722 |
gcagcttgtgctgtaagtggggctctatatacattaatttgttgtgtgacgggttgtggttgtttatactcatgcatctaccgtaacaaaatgagacaac |
44221821 |
T |
|
| Q |
349 |
aatacatgctcaaagacactccttgttgtgattgcttagttcatt |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44221822 |
aatacatgctcaaagacactccttgttgtgattgcttagttcatt |
44221866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 96 - 173
Target Start/End: Original strand, 44221559 - 44221636
Alignment:
| Q |
96 |
ggttgcataacgtacttgtgtccatgcatcacctttggacgaattgccgagattgtggacaagggatcaacttgtaag |
173 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44221559 |
ggttgcataacgtactggtgtccatgcatcacctttggacgaattgccgagattgttgacaagggatcaacttgtaag |
44221636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University