View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21062_low_5 (Length: 427)
Name: NF21062_low_5
Description: NF21062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21062_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 4 - 414
Target Start/End: Original strand, 2290172 - 2290567
Alignment:
| Q |
4 |
agacaaagcatgcacaataattcgtttcgccggttcagccatcaatgtaggcttctcagctatcacagtttcaccttccacattactttgcttaatttcc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2290172 |
agacaaagcatgcacaataattcgtttcgccggttcggccatcaatgtaggcttctcagctatcacagtttcagcttccacattactttgcttaatttcc |
2290271 |
T |
|
| Q |
104 |
tcagcattgacgttcttatcagcatcactgggatcggctttcagttcttcagcagaagacttctccttttccttgacttcctgtgaaggagactcagttt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2290272 |
tcagcattgacgttcttatcagcatcactgggatcagctttcagttcttcagcagaagacttccccttttccttgacttcctctgaaggagactcagttt |
2290371 |
T |
|
| Q |
204 |
cagtttccttgtcctccttctttgaaccagatgattttcgactacgtttcttcagaggctcagcttgtgcaggtggaggggttgttttggcagtctccct |
303 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2290372 |
cagtttccttgtcctccttc---------------tttcgactacgtttcttcggaggctcagcttgtgcaggtggaggggttgttttggcagtctccct |
2290456 |
T |
|
| Q |
304 |
aatccttgttgatcgccttggcgtctcgccggttccccaatgaaactctgatatgtcaggattcccagaatgatttttcaggtacttcttcaattgtgct |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2290457 |
aatccttgttgatcgccttggcgtctcgccggttccccaatgaaactctgatatatcaggatccccagaatgatttttcaggtacttcttcaattgtgct |
2290556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University