View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21063_high_12 (Length: 355)
Name: NF21063_high_12
Description: NF21063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21063_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 9e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 7 - 139
Target Start/End: Complemental strand, 32938756 - 32938620
Alignment:
| Q |
7 |
cagagaggcagtgaaccaattcaaaaatgttgcagcacttccagcaagccccttaatatttggtggaagtatctgaaaaccacaccattaatta----at |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
32938756 |
cagagaggcagtgaaccaattcaaaaatgttgcagcacttccagcaagccccttaatatttggtggaagtatctgaaaaccaaaccattaattaatttat |
32938657 |
T |
 |
| Q |
103 |
caattaccatatgcagtggcatacaatgtaataatat |
139 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
32938656 |
caattaccacatgcagtggcataccttgtaataatat |
32938620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University