View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21063_high_18 (Length: 283)
Name: NF21063_high_18
Description: NF21063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21063_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 76 - 266
Target Start/End: Complemental strand, 6491321 - 6491131
Alignment:
| Q |
76 |
gaatggtctaaagatccgcatggccaaatctggtaatagataaacaactggaatgtttggaaaaacccaacatactttcatcactcgaccacattacata |
175 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6491321 |
gaatggtctaaagatccgcatggcaaaatctggtaatagataaacaactggaatgtttggaaaaacccaacatactttcatcactcgaccacattacata |
6491222 |
T |
 |
| Q |
176 |
aacaagttcggcttcttggccttgtatgttgtcttcagcttcttggatggtggtgtgattttcttgaaaaccaatgggagcttgatctttg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6491221 |
aacaagttcggcttcttggccttgtatgttgtcttcagcttcttgggtggtggtgtgattttcttgaaaaccaatgggaacttgatctttg |
6491131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 68
Target Start/End: Complemental strand, 6491420 - 6491368
Alignment:
| Q |
16 |
atgatataatgataaatttcaagcaaattggtataaatttgttcgattctact |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6491420 |
atgatataatgataaatttcaagcaaattggtataaatttgttcgattctact |
6491368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University