View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21063_high_26 (Length: 220)
Name: NF21063_high_26
Description: NF21063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21063_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 15 - 128
Target Start/End: Original strand, 8217016 - 8217129
Alignment:
| Q |
15 |
aatatagatagtgtgagatgtacttagatgtatgtgcaaaagtttaacatccaaaacatgcacaaataaatttattaagatatggtcttttcaaacttgt |
114 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8217016 |
aatatagatagtatgagatgtacttagatgtatgtgcaaaagtttaacatccaaaacatgcacaaataaatttattaagatatggtcttttcaaacttgt |
8217115 |
T |
 |
| Q |
115 |
tttaagaatcagac |
128 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8217116 |
attaagaatcagac |
8217129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University