View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21063_high_26 (Length: 220)

Name: NF21063_high_26
Description: NF21063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21063_high_26
NF21063_high_26
[»] chr6 (1 HSPs)
chr6 (15-128)||(8217016-8217129)


Alignment Details
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 15 - 128
Target Start/End: Original strand, 8217016 - 8217129
Alignment:
15 aatatagatagtgtgagatgtacttagatgtatgtgcaaaagtttaacatccaaaacatgcacaaataaatttattaagatatggtcttttcaaacttgt 114  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8217016 aatatagatagtatgagatgtacttagatgtatgtgcaaaagtttaacatccaaaacatgcacaaataaatttattaagatatggtcttttcaaacttgt 8217115  T
115 tttaagaatcagac 128  Q
     |||||||||||||    
8217116 attaagaatcagac 8217129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University