View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21063_high_27 (Length: 212)
Name: NF21063_high_27
Description: NF21063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21063_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 11 - 195
Target Start/End: Original strand, 505351 - 505535
Alignment:
| Q |
11 |
catcatcattagtggtaaatgttgaagttgaagatgagaaatgttcttcttgtcttggttcagctacaaatacagtgtttgcagcttttgcagcagcagc |
110 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
505351 |
catcatcattattggtaaatgttgaacttgaagatgagaaatgttcttcttgtattggttcagctacaaatacagtgtttgcagcttttgcagcagcagc |
505450 |
T |
 |
| Q |
111 |
ttgaatgtcttttgtagaagtacttattggctttggaagttgttgtaccaattcagggaaattaaggtatgctgaatgacccttt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
505451 |
ttgaatgtcttttgtagaagtacttattggctttggaagttgttgtaccaattcagggaaattaaggtatgctgaatgacccttt |
505535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University