View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21063_high_9 (Length: 412)
Name: NF21063_high_9
Description: NF21063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21063_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 14 - 400
Target Start/End: Complemental strand, 25873187 - 25872801
Alignment:
| Q |
14 |
atttgaatgaatctggtttagaaaaagacaaattttctgagattcaaaaggctgttacggttgcttgggttaaagggaagaaaatgtgggaagaaattca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25873187 |
atttgaatgaatctggtttagaaaaagacaaattttctgagattcaaaaggctgttaaggttgcttgggttaaagggaagaaaatgtgggaagaaattca |
25873088 |
T |
 |
| Q |
114 |
gtttcagagtgttgaaactgtgaatgttgctgagaatatttctgattcgtgtcggcattcgatttcggtatctgggtctgaattaaggaaccagaatggg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25873087 |
gtttcagagtgttgaaactgtgaatgttgctgagaatatttctgattcgtgtcggcattcgatttcggtatctgggtctgaattaaggaaccagaatggg |
25872988 |
T |
 |
| Q |
214 |
attatgatgattccttgtgggttgactttgtggtctcatgttactattgttgggacgccgcgattggctcattgggaggatgatcctaagataactattg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25872987 |
attatgatgattccttgtgggttgactttgtggtctcatgttactattgttgggacgccgcgattggctcattgggaggatgatcctaagataactattg |
25872888 |
T |
 |
| Q |
314 |
tgaaagatgaggatgaaaaggtgttggtgtcacagtttatgatggagcttcaagggttgaaggtagttgataaggaggaaccaccta |
400 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25872887 |
tgaaagatgaggatgaaaaggtgttagtgtcacagtttatgatggagcttcaaggattgaaggtagttgataaggaggaaccaccta |
25872801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University