View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21063_low_11 (Length: 405)
Name: NF21063_low_11
Description: NF21063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21063_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 15 - 395
Target Start/End: Original strand, 29135115 - 29135495
Alignment:
| Q |
15 |
gtcttctctgaatccttcatttgaacaaacaagtgtttgttgcaacctcttacacttactattcctaacaagcttgcttttccggatagagaaaccattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29135115 |
gtcttctctgaatccttcatttgaacaaacaaatgtttgttgcaacctcacacacttactattcctaacaaccttgcttttccggatagagaaaccattt |
29135214 |
T |
 |
| Q |
115 |
attttgataggccacttctagatcaccaaaatcaaacctgctaacattgttagtgttaatatttttcatatcaaaattcacaatatttgtcaagttatat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
29135215 |
attttgataggccacttctagatcaccaaaatcaaacctgctaacattgttagtgttaatatttttcatatcaaaattcacaatatctttcaagttatat |
29135314 |
T |
 |
| Q |
215 |
atatggtgatttcatcttctaattcttcactactacaatgtgaatcatcatcaccatccaccccactatccccttctcctttaccatcatcatattcatc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
29135315 |
atatggtgatttcatcttctaattcttcactactacaatgtgaatcatcatcaccatccaccccactatcccctgctccttcaccatcatcatattcatc |
29135414 |
T |
 |
| Q |
315 |
ctcaccaccatcttcaccctcaacgtcatactgactactatcacctccatcaccgtcttcattctcaccaccatcttcatc |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29135415 |
ctcaccaccatcttcaccctcaacgtcatactgaccactatcacctccatcaccgtcttcattctcaccaccatcttcatc |
29135495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University