View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21063_low_20 (Length: 283)

Name: NF21063_low_20
Description: NF21063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21063_low_20
NF21063_low_20
[»] chr2 (2 HSPs)
chr2 (76-266)||(6491131-6491321)
chr2 (16-68)||(6491368-6491420)


Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 76 - 266
Target Start/End: Complemental strand, 6491321 - 6491131
Alignment:
76 gaatggtctaaagatccgcatggccaaatctggtaatagataaacaactggaatgtttggaaaaacccaacatactttcatcactcgaccacattacata 175  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6491321 gaatggtctaaagatccgcatggcaaaatctggtaatagataaacaactggaatgtttggaaaaacccaacatactttcatcactcgaccacattacata 6491222  T
176 aacaagttcggcttcttggccttgtatgttgtcttcagcttcttggatggtggtgtgattttcttgaaaaccaatgggagcttgatctttg 266  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
6491221 aacaagttcggcttcttggccttgtatgttgtcttcagcttcttgggtggtggtgtgattttcttgaaaaccaatgggaacttgatctttg 6491131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 68
Target Start/End: Complemental strand, 6491420 - 6491368
Alignment:
16 atgatataatgataaatttcaagcaaattggtataaatttgttcgattctact 68  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
6491420 atgatataatgataaatttcaagcaaattggtataaatttgttcgattctact 6491368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University