View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21063_low_21 (Length: 280)

Name: NF21063_low_21
Description: NF21063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21063_low_21
NF21063_low_21
[»] chr5 (1 HSPs)
chr5 (1-267)||(14201307-14201573)
[»] chr8 (1 HSPs)
chr8 (1-36)||(37701781-37701816)
[»] chr4 (1 HSPs)
chr4 (1-31)||(29051289-29051319)
[»] chr1 (1 HSPs)
chr1 (4-32)||(42603678-42603706)


Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 14201307 - 14201573
Alignment:
1 taattattgtaactaactattacatctaataatactgaccggagaattgtatagagcgatcaacggagagaacgcgattatggccaccgaggtaacggag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14201307 taattattgtaactaactattacatctaataatactgaccggagaattgtatagagcgatcaacggagagaacgcgattatggccaccgaggtaacggag 14201406  T
101 tttgccatccgggtaacgggggaggattttgccaccatagctacagaggaatttgatggtggatttgggagaacccgaagcgggttcagagagtccgatc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14201407 tttgccatccgggtaacgggggaggattttgccaccatagctacagaggaatttgatggtggatttgggagaacccgaagcgggttcagagagtccgatc 14201506  T
201 atgataggttcgggttcggatgtggattgagaatggttcagtttaggtttggatgatgattgtgtct 267  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||    
14201507 atgataggttcgggttcggatgtggattgagaaaggttcagtttaggtttggatgatgattgggtct 14201573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 37701781 - 37701816
Alignment:
1 taattattgtaactaactattacatctaataatact 36  Q
    |||||||||||||||||||||||| |||||||||||    
37701781 taattattgtaactaactattacaactaataatact 37701816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 29051319 - 29051289
Alignment:
1 taattattgtaactaactattacatctaata 31  Q
    |||||||||||||||||||||||||||||||    
29051319 taattattgtaactaactattacatctaata 29051289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 32
Target Start/End: Original strand, 42603678 - 42603706
Alignment:
4 ttattgtaactaactattacatctaataa 32  Q
    |||||||||||||||||||||||||||||    
42603678 ttattgtaactaactattacatctaataa 42603706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University