View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21063_low_24 (Length: 250)
Name: NF21063_low_24
Description: NF21063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21063_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 10 - 233
Target Start/End: Original strand, 505312 - 505535
Alignment:
| Q |
10 |
catcatcaggaaaaagatctggcaaatcaaacaatgtagcatcatcattagtggtaaatgttgaagttgaagatgagaaatgttcttcttgtcttggttc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
505312 |
catcatcaggaaaaagatctggcaaatcaaacaatgtagcatcatcattattggtaaatgttgaacttgaagatgagaaatgttcttcttgtattggttc |
505411 |
T |
 |
| Q |
110 |
agctacaaatacagtgtttgcagcttttgcagcagcagcttgaatgtcttttgtagaagtacttattggctttggaagttgttgtaccaattcagggaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
505412 |
agctacaaatacagtgtttgcagcttttgcagcagcagcttgaatgtcttttgtagaagtacttattggctttggaagttgttgtaccaattcagggaaa |
505511 |
T |
 |
| Q |
210 |
ttaaggtatgctgaatgacccttt |
233 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
505512 |
ttaaggtatgctgaatgacccttt |
505535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University