View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21064_high_4 (Length: 412)
Name: NF21064_high_4
Description: NF21064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21064_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 5e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 70 - 216
Target Start/End: Original strand, 44655966 - 44656107
Alignment:
| Q |
70 |
tttttgttgagtttaaaattgtttcttggtacataaatcagttttgaactacataaatctattttcaggatgtagaaatcgattattagaggatcatgaa |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44655966 |
tttttgttgagtttaaaattgtttcttggtacataaatcagttttgaactacataaatctattttcaggatgtagaaatcgattattag-----gatgaa |
44656060 |
T |
 |
| Q |
170 |
ctttgagatatttctgaaaaaattgattactagtcttagattataag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44656061 |
ctttgagatatttctgaaaaaattgattactagtcttagattataag |
44656107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 265 - 377
Target Start/End: Original strand, 44656110 - 44656222
Alignment:
| Q |
265 |
attccctattgtttgtagtcttcttcgtttgcccacccatagagttataattaaactgttcccttttaaacatctcattcggcttcgctttatgcataat |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44656110 |
attccctattgtttgtagtcttcttcgtttgcctacccatagagttataattaaactgttcccttttaaacatctcattcggcttcgctttatgcataat |
44656209 |
T |
 |
| Q |
365 |
gcttgttctttga |
377 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44656210 |
gcttgttctttga |
44656222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University