View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21064_low_12 (Length: 257)
Name: NF21064_low_12
Description: NF21064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21064_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 28 - 240
Target Start/End: Original strand, 26018856 - 26019067
Alignment:
| Q |
28 |
acttataactcgatttatgcaagtttggttatgggaccgatcttgatcaactctaccaaattaaactaagtaactaacctacacatccctatgacctatg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26018856 |
acttataactcgatttatgcaagtttggttatgggaccgatcttgatcaactctaccaaattaaactaagtaactaacctacacatccctatgacctatg |
26018955 |
T |
 |
| Q |
128 |
tatgtactaagctnnnnnnntagctccatagaatgcagaacataattgtgtcactaaaagacaaataattttccattttacactaaacataagagattga |
227 |
Q |
| |
|
||||||||||||| | ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26018956 |
tatgtactaagctaaaaaaattgctccatagaacgcagaacataattgtg-cactaaaagacaaataattttccattttacactaaacataagagattga |
26019054 |
T |
 |
| Q |
228 |
gtttgtgtggtat |
240 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26019055 |
gtttgtgtggtat |
26019067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University