View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21065_high_11 (Length: 245)
Name: NF21065_high_11
Description: NF21065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21065_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 19240572 - 19240344
Alignment:
| Q |
1 |
tgatcataggtactaaaacagtatagattctagtatgatcttattttgtatatatttttgttgatgaagctagagattagtcgatgaatcagtttgagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19240572 |
tgatcataggtactaaaacagtatagattctagtataatcttattttgtatatatttttgttgatgaagctagagattagtcgatgaatcagtttaagtc |
19240473 |
T |
|
| Q |
101 |
atcaactgtgattctctttctttaagggattgaagttgattccctttcgttaagtatgatagtttttgaattttttgttactagactaagaaatgcatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19240472 |
ctcaactgtgattctctttctttaagggattgaagttgattccctttcgttaagtatgatagtttttgaatttttcgttactagactaagaaatgcatac |
19240373 |
T |
|
| Q |
201 |
aaactaagattaaggaagagtggtaaatg |
229 |
Q |
| |
|
|||||||||||| |||||||||||||||| |
|
|
| T |
19240372 |
aaactaagattatggaagagtggtaaatg |
19240344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University