View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21065_low_6 (Length: 364)
Name: NF21065_low_6
Description: NF21065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21065_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 108 - 359
Target Start/End: Original strand, 19240945 - 19241208
Alignment:
| Q |
108 |
acactaatgatcatttatcaatgatttcaacgtcaaattttatttatcaacgatttcattggactatctttttccgagtgagctatcataggtttgacca |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
19240945 |
acactaatgatcatttatcaatgatttcaacgtcaaattttatttatcatcgatttcattggactatttttttcctagtgaactatcataggtttgacca |
19241044 |
T |
 |
| Q |
208 |
ttttgtccagcacaaagagaggtcatgtctcaaccgtttaactctttaaacatcacctcattagataaa------------tggtgtggagaaaacctgc |
295 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19241045 |
ttctgtcaagcacaaagagaggtcatgtctcaaccgtttaactctttaaacatcacctcattagataaatggtttgataattggtgtggagaaaacctgc |
19241144 |
T |
 |
| Q |
296 |
atggtaacgaggatagtcatccctcttgtactcgctttctcttaacggcgatctctgtgctgct |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19241145 |
atggtaacgaggatagtcatccctcttgtactcgctttctcttaacggcgatctctgtgatgct |
19241208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University