View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21066_low_2 (Length: 248)
Name: NF21066_low_2
Description: NF21066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21066_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 5 - 237
Target Start/End: Complemental strand, 46244761 - 46244525
Alignment:
| Q |
5 |
aacttatacaacaactcactaaatagtataaaaagagatttttaattgcaattttacttcatctttcaatcatatcttaaagtaatctctaagcggaaaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46244761 |
aacttatacaacaactcactaaatagtataaaaagagatttttaattgcaattttacttcatctttcaatcatatcttaaagtaatctctaagcggaaaa |
46244662 |
T |
|
| Q |
105 |
acgccgagtgagcttggctattcac----ttggagcgactgtggtattcacttcgtgcttgtctatcgtgattttgccaagctaaccgtcaatttaatca |
200 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46244661 |
acgccgagtgagcttggctatgtacatgtttggagcgactgtggtattcacttcgtgcttgtctatcgtgattttgccaagctaaccgtcaatttaatca |
46244562 |
T |
|
| Q |
201 |
aagatatacaccacgaccaaaattcacaactttgtct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46244561 |
aagatatacaccacgaccaaaattcacaactttgtct |
46244525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 29 - 104
Target Start/End: Original strand, 46163349 - 46163426
Alignment:
| Q |
29 |
agtataaaaagagatttttaattgcaattttacttcatctttc--aatcatatcttaaagtaatctctaagcggaaaa |
104 |
Q |
| |
|
|||| ||||| |||||| ||||||||||||||||| ||||||| | |||||||||||||| || ||||| ||||||| |
|
|
| T |
46163349 |
agtaaaaaaaaagatttataattgcaattttactttatctttcagagtcatatcttaaagttatttctaatcggaaaa |
46163426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University