View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21066_low_4 (Length: 215)
Name: NF21066_low_4
Description: NF21066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21066_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 14 - 197
Target Start/End: Complemental strand, 13878705 - 13878522
Alignment:
| Q |
14 |
agagaagagcgagggttagttatctccaaatggagactttgaataggacaattttgcagtttattatcatgttaacctgtgagttgaataggtatataga |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13878705 |
agagaagagcgagggtgagttatctccaaatggagactttgaataggacaattttgcagtttattatcatgttaacctgtgagttgaataggtatataga |
13878606 |
T |
|
| Q |
114 |
ttgattatcattggtttgcagcaagttaagatattgggagcagatagatggtctcattctattatgaaaccagcttgagttaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13878605 |
ttgattatcattggtttgcagcaagttaagatattgggagcagatagatggtctcaatctattatgaaaccagcttgagttaat |
13878522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 81 - 195
Target Start/End: Original strand, 14367071 - 14367182
Alignment:
| Q |
81 |
catgttaacctgtgagttgaataggtatatagattgatta-tcattggtttgcagcaagttaagatattgggagcagatagatggtctcattctattatg |
179 |
Q |
| |
|
||||||||||||||||| ||||||| || ||||||||||| | ||||||| ||||||||| ||||||||||||| |||||||||||||||| ||| |
|
|
| T |
14367071 |
catgttaacctgtgagtggaataggaatttagattgattactatttggtttacagcaagttcagatattgggagc----agatggtctcattctaatata |
14367166 |
T |
|
| Q |
180 |
aaaccagcttgagtta |
195 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
14367167 |
aaaccagcttgtgtta |
14367182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 24 - 77
Target Start/End: Complemental strand, 16024864 - 16024811
Alignment:
| Q |
24 |
gagggttagttatctccaaatggagactttgaataggacaattttgcagtttat |
77 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
16024864 |
gagggtgagttatctccaaatggagactttgaagaggataattttgcagtttat |
16024811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 195
Target Start/End: Complemental strand, 13881339 - 13881258
Alignment:
| Q |
110 |
tagattgattatcattggtttgcagcaagttaagatattgggagcagatagatggtctcattctattatgaaaccagcttgagtta |
195 |
Q |
| |
|
|||||||| ||||||||| |||||| ||||||||||||||| ||| |||||||||||| |||| || ||||||||||| |||| |
|
|
| T |
13881339 |
tagattgactatcattggattgcagaaagttaagatattggaagc----agatggtctcatcctatcataaaaccagcttgtgtta |
13881258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University