View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21067_low_3 (Length: 297)
Name: NF21067_low_3
Description: NF21067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21067_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 41589277 - 41589069
Alignment:
| Q |
14 |
agaagcaaaggaacagaacaaaaatagtcaaaaagcaaaagaggatgaagttccacaagaaagagttattacccttagaccattgaatatgcaggatttc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41589277 |
agaagcaaaggaacagaacaaaaatagtcaagaagcaaaagaggatgaagttccacaagaaagagttattacccttaggccattgaatatgcaggatttc |
41589178 |
T |
 |
| Q |
114 |
aaagaggccaagaatcaggttgctgcaagcttctctgccgagggagctggaatgggtgagctgacacaatggaatgagctgtacggagaaggtggttcta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41589177 |
aaagaggccaagaatcaggttgctgcaagcttctctgccgagggagctggaatgggtgagctgacacaatggaatgagctgtacggagaaggtggttcta |
41589078 |
T |
 |
| Q |
214 |
ggaagcaaa |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
41589077 |
ggaagcaaa |
41589069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 72 - 133
Target Start/End: Original strand, 2490908 - 2490969
Alignment:
| Q |
72 |
gaaagagttattacccttagaccattgaatatgcaggatttcaaagaggccaagaatcaggt |
133 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |||||| ||| |||| |||||| |
|
|
| T |
2490908 |
gaaagagttattacccttaggcctttgaatatgcaggacttcaaaatggcaaagagtcaggt |
2490969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University