View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21068_high_11 (Length: 323)
Name: NF21068_high_11
Description: NF21068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21068_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 12 - 309
Target Start/End: Original strand, 46231812 - 46232109
Alignment:
| Q |
12 |
gaagcaaaggaataataacatttggaacaacgactcagaatctagagcagtggtatgtgactggctgggaaaatgcccaaaaattcagaatttctgccac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46231812 |
gaagcaaaggaataataacatttggaacaacgactcagaatctagagcagtggtatgtgactggctgggaaaatgcccaagaattcagaatttctgccac |
46231911 |
T |
|
| Q |
112 |
tgtacaacagcatttgaaaccatcactttggtcaaaacctcaattaggaagatacatatccaatggtgaggcctcgttctctcatgatcataacaaggtg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46231912 |
tgtacaacagcatttgaaaccatcactttggtcaaaacctcaattaggaagatacatatccaatggtgaggcctcgttctctcatgatcataacaaggtg |
46232011 |
T |
|
| Q |
212 |
gatattggtgtttgtattcgtgatgatcaagggggcactctgttcctgctaaaacagaatggattgaccctcttatggaagttgatattggtgatttt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46232012 |
gatattggtgtttgtattcgtgatgatcaagggggcactctgttcctgctaaaacagaatggattgaccctcttatggaagttgatattggtgatttt |
46232109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 252 - 305
Target Start/End: Original strand, 37804555 - 37804608
Alignment:
| Q |
252 |
tgttcctgctaaaacagaatggattgaccctcttatggaagttgatattggtga |
305 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
37804555 |
tgttcttgctgaaacagaatggattgaacctcttatgaaagttgatattggtga |
37804608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University