View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21068_high_16 (Length: 266)
Name: NF21068_high_16
Description: NF21068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21068_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 130 - 252
Target Start/End: Complemental strand, 32103099 - 32102977
Alignment:
| Q |
130 |
agtgtctatttgttacgtgggttttatcatgttttacaatcatttggttttgcaggaggcaatgcggaaggctgaagctgctggaaatgatgactgtcct |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
32103099 |
agtgtctatttgttatgtgggttttatcatgttttacaatcatttggttttgcaggaggcaatgcagaaggctgaagctgctggaaatgatgactgccct |
32103000 |
T |
 |
| Q |
230 |
gtggaaattaaacttgttgctcc |
252 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32102999 |
gtggaaattaaacttgttgctcc |
32102977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 138 - 252
Target Start/End: Complemental strand, 32108946 - 32108832
Alignment:
| Q |
138 |
tttgttacgtgggttttatcatgttttacaatcatttggttttgcaggaggcaatgcggaaggctgaagctgctggaaatgatgactgtcctgtggaaat |
237 |
Q |
| |
|
||||||| ||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |||| |
|
|
| T |
32108946 |
tttgttatgtgggttttgtcatgttcgataatcatttggttttgcaggaggcaatgcggaaggctgaagctactggaaatgatgactgccctgtgaaaat |
32108847 |
T |
 |
| Q |
238 |
taaacttgttgctcc |
252 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32108846 |
taaacttgttgctcc |
32108832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 32117207 - 32117121
Alignment:
| Q |
167 |
aatcatttggttttgcaggaggcaatgcggaaggctgaagctgctggaaatgatgactgtcctgtggaaattaaacttgttgctcct |
253 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
32117207 |
aatcatttggctttgcaggaggcaatgcggaaggctgaagctgctggaaatgatgactgtcctgtgaatattaaacttgttgctcct |
32117121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 15 - 66
Target Start/End: Complemental strand, 32103214 - 32103163
Alignment:
| Q |
15 |
gaaatgaaatgttttcaatttgatggaattatacacattaaggtcttaatca |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103214 |
gaaatgaaatgttttcaatttgatggaattatacacattaaggtcttaatca |
32103163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 15 - 66
Target Start/End: Complemental strand, 32109058 - 32109007
Alignment:
| Q |
15 |
gaaatgaaatgttttcaatttgatggaattatacacattaaggtcttaatca |
66 |
Q |
| |
|
||||||||||||||||||||||||||| || | ||||||||||||||||||| |
|
|
| T |
32109058 |
gaaatgaaatgttttcaatttgatggagttctccacattaaggtcttaatca |
32109007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 61
Target Start/End: Complemental strand, 32117336 - 32117290
Alignment:
| Q |
15 |
gaaatgaaatgttttcaatttgatggaattatacacattaaggtctt |
61 |
Q |
| |
|
||||||||||||||||||||||||||| || | |||||||||||||| |
|
|
| T |
32117336 |
gaaatgaaatgttttcaatttgatggagttctccacattaaggtctt |
32117290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University