View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21068_low_15 (Length: 281)
Name: NF21068_low_15
Description: NF21068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21068_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 47371932 - 47372178
Alignment:
| Q |
1 |
aattttctttgaaggaagctcaccaacttggtaaaataagaatgtatatgtcattttgaatgtatagtcaattacttactttgtttatgaaaaaattatt |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47371932 |
aattttcattgaaggaagctcaccaacttggtaaaataagaatgtatatgtcattttgaatgtatagtcaattacttactttgtttatgaaaaaaaattt |
47372031 |
T |
|
| Q |
101 |
atgacttgttatttccatgatatattacaaatttaaagtaagttgaaatttatctagaaactagagttggttgattttctgaccaacctttattcgtgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47372032 |
atgacttgttatttccatgatatattacaaatttaaagtaagttgaaatttatctagaaactagagttggttgattttctgaccaacctttattcgtgta |
47372131 |
T |
|
| Q |
201 |
tgatac-tttatttgcactcacttgctgaaaaggtttatattttaga |
246 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47372132 |
tgatacttttatttgcgctcacttgctgaaaaggtttatattttaga |
47372178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University