View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21068_low_21 (Length: 246)
Name: NF21068_low_21
Description: NF21068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21068_low_21 |
 |  |
|
| [»] scaffold0864 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 96 - 237
Target Start/End: Complemental strand, 5332130 - 5331989
Alignment:
| Q |
96 |
tagtggatccgcatccgcagctgtttgatccagaaccagaacgggatccagatccggaaccagatccaaaactaatatcggaatttgtaaggattcacga |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5332130 |
tagtggatccgcatccgcagctgtttgatccagaaccagaacgggatccagatccggaaccagatccagaactaatatcggaatttgtaaggattcacga |
5332031 |
T |
 |
| Q |
196 |
catattcttaagtttcaagggggaggatactcgttcttcctt |
237 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
5332030 |
catattcttaagtttcaggggggaggatactcattcttcctt |
5331989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 152 - 237
Target Start/End: Complemental strand, 5264545 - 5264460
Alignment:
| Q |
152 |
gaaccagatccaaaactaatatcggaatttgtaaggattcacgacatattcttaagtttcaagggggaggatactcgttcttcctt |
237 |
Q |
| |
|
|||||||||||| || |||||| ||||||||||||||||| ||| | ||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
5264545 |
gaaccagatccagaagcaatatcagaatttgtaaggattcatgacgtgttcttaagtttcaggggagaggatactcgttcttcctt |
5264460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 237
Target Start/End: Original strand, 5360712 - 5360809
Alignment:
| Q |
140 |
gatccagatccggaaccagatccaaaactaatatcggaatttgtaaggattcacgacatattcttaagtttcaagggggaggatactcgttcttcctt |
237 |
Q |
| |
|
||||| |||||| || || ||||| ||| |||||| |||| | || ||||||||||| | ||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
5360712 |
gatcctgatccgaaatcatatccagaaccaatatcagaatctatagggattcacgacgtgttcttaagttttaggggagaggatactcgttcttcctt |
5360809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 144 - 234
Target Start/End: Original strand, 5394143 - 5394233
Alignment:
| Q |
144 |
cagatccggaaccagatccaaaactaatatcggaatttgtaaggattcacgacatattcttaagtttcaagggggaggatactcgttcttc |
234 |
Q |
| |
|
|||| ||||| ||||| ||||||||| | ||||| ||||||||||||||| | ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
5394143 |
cagacccggatccagaatcaaaactaaaaccggaacgagtaaggattcacgacgtgttcttaagtttcagaggggaggacactcgttcttc |
5394233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 237
Target Start/End: Original strand, 4241 - 4309
Alignment:
| Q |
169 |
aatatcggaatttgtaaggattcacgacatattcttaagtttcaagggggaggatactcgttcttcctt |
237 |
Q |
| |
|
|||||| |||| |||||||||||| || | ||||||||||||| ||| | ||||||||||||| |||| |
|
|
| T |
4241 |
aatatcagaatctgtaaggattcatgatgtgttcttaagtttcaggggagtggatactcgttctacctt |
4309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University