View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21068_low_22 (Length: 241)
Name: NF21068_low_22
Description: NF21068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21068_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 70 - 199
Target Start/End: Original strand, 25627522 - 25627651
Alignment:
| Q |
70 |
tagttggttaacttgtggaccaagttatctcacttagcctataaatagtttgtaattagttgatatatctcatatcaatatcttgaatcataactattat |
169 |
Q |
| |
|
||||||||||||||| | | ||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25627522 |
tagttggttaacttgggaagaaagttatctcactaagcctataaatagtttgtaatcagttaatatatctcatatcaatatcttgaatcataactattat |
25627621 |
T |
|
| Q |
170 |
tcaatacaaaaacataactctcttcattct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25627622 |
tcaatacaaaaacataactctcttcattct |
25627651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 178
Target Start/End: Complemental strand, 19247805 - 19247761
Alignment:
| Q |
134 |
atatctcatatcaatatcttgaatcataactattattcaatacaa |
178 |
Q |
| |
|
||||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
19247805 |
atatcacatatcaatatcttgtatcataaccattattcaatacaa |
19247761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 25621088 - 25621122
Alignment:
| Q |
1 |
cgtattatgatttttaagctaatttctacattttt |
35 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25621088 |
cgtatgatgatttttaagctaatttctacattttt |
25621122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University