View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21068_low_31 (Length: 224)
Name: NF21068_low_31
Description: NF21068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21068_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 14 - 206
Target Start/End: Complemental strand, 42460942 - 42460750
Alignment:
| Q |
14 |
aatatccaaattacacacaaaataaaatgaaaaagtgattaaagtaagaccttgttgatctgcagtggctttaggtgaaagtaggaataatctgcggcga |
113 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42460942 |
aatatccaaattacacgcaaaataaaatgaaaaggtgattaaagtaagaccttgttgatctgcagtggctttaggtgaaagtaggaataatctgcggcga |
42460843 |
T |
|
| Q |
114 |
aggcataagtggcgggaattaaggtgacgaggagaaacagaagaaaaagagaatggaatgaagggtgttgggggtgcagaacatggacgaggg |
206 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42460842 |
aggcataagtggcgggaattaaggtgaggaggagaaacagaagaaaaagagaatggaatgaagggtgttgggggtgcagaacatggacgaggg |
42460750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University