View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21068_low_34 (Length: 207)
Name: NF21068_low_34
Description: NF21068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21068_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 32214495 - 32214316
Alignment:
| Q |
19 |
gtttagccgtaatcaatttgtcactgcaaaaccatcatacaagtggattatga----ccaagtttctgacagatttttcaataatctgaaataaaaatta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32214495 |
gtttagccgtaatcaatttgtcactgcaaaaccatcatacaagtggattatgatacaccaagtttctgacagatttttcaataatctgaaataaaaatta |
32214396 |
T |
 |
| Q |
115 |
atgtatgaaccaaattaatgtatttttgtcatgttttgtatcatcaataaacttgattttgcttaccctcattttatttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32214395 |
atgtatgaaccaaattaatgtatttttgtcatgttttgtatcatcaataaacttgattttgcttaccctcattttatttt |
32214316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University