View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21069_low_5 (Length: 237)
Name: NF21069_low_5
Description: NF21069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21069_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 42293021 - 42293123
Alignment:
| Q |
1 |
caattgtggtccagtgcatattaccattggggatggaggcaatcgtgaaggcctagccacaaggtaattaatacttttattcttttcctaaacattacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42293021 |
caattgtggtccagtgcatattaccattggggatggaggcaatcgtgaaggcctagccacaaggtaattaatacttttattcttttcctaaacattacca |
42293120 |
T |
|
| Q |
101 |
aag |
103 |
Q |
| |
|
||| |
|
|
| T |
42293121 |
aag |
42293123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 117 - 223
Target Start/End: Original strand, 42293156 - 42293262
Alignment:
| Q |
117 |
taaataattgtatgtggtatgtgatgataggtaccaagatcctaagccggagatatcaatattcagggaggctagctttggacatggagtattagaggtt |
216 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42293156 |
taaataattttatgtggtatgtgatgataggtaccaagatcctaagccggagatatcaatattcagggaggctagctttggacatggagtattagaggtg |
42293255 |
T |
|
| Q |
217 |
gttaatg |
223 |
Q |
| |
|
||||||| |
|
|
| T |
42293256 |
gttaatg |
42293262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University